View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17844_high_64 (Length: 214)
Name: NF17844_high_64
Description: NF17844
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17844_high_64 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 22 - 204
Target Start/End: Complemental strand, 40467640 - 40467458
Alignment:
| Q |
22 |
taagcttaaatgtaaaacatgtccctaagctaaattaaaagtaaacttatatatcatctcattggacgccataattgatggtacaagatatgtattggca |
121 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
40467640 |
taagcttaaatgtaaaacatgttcctaagctaaattaaaagtaaacttatatatcatctcattggacgccataattgatggtacaggatatgtattggca |
40467541 |
T |
|
| Q |
122 |
aatgcactagtgtgtgtcgtggtgtgtgattaaaggtagaatgtcttatatgatagtatatcatcatggtttttcagaattat |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40467540 |
aatgcactagtgtgtgtcgtggtgtgtgattaaaggtagaatgtcttatatgatagtatatcatcatggtttttcagaattat |
40467458 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University