View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17844_high_7 (Length: 537)
Name: NF17844_high_7
Description: NF17844
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17844_high_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 494; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 494; E-Value: 0
Query Start/End: Original strand, 5 - 522
Target Start/End: Original strand, 22644604 - 22645121
Alignment:
| Q |
5 |
gagtgagatgaacaaaggattgtgagtgaatcggagcatgtgattaaatcagtcctatccatgtattatgacgtatggaaaaataggaacaagagtgctt |
104 |
Q |
| |
|
||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22644604 |
gagtgggatgaacaagggattgtgagtgaatcggagcatgtgattaaatcagtcctatccatgtattatgacgtatggaaaaataggaacaagagtgctt |
22644703 |
T |
 |
| Q |
105 |
tgacggatatgatattcccggtgcagcagacgggggttagggactgtcggcagtaactcgtgatgctgacagagtagttgaacttgttgctctgaactgc |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22644704 |
tgacggatatgatattcccggtgcagcagacgggggttagggactgtcagcagtaactcgtgatgctgacagagtagttgaacttgttgctctgaactgc |
22644803 |
T |
 |
| Q |
205 |
tgtaaaaacatgatgtggacgggctatgtcaatgaaggctggactgcaatttgtaagggagatactctttttaaatttatttgccgaatctgattctcta |
304 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22644804 |
tgtaaaaacatgatgtggacgggctatggcaatgaaggctggactgaaatttgtaagggagatactctttttaaatttatttgccgaatctgattctcta |
22644903 |
T |
 |
| Q |
305 |
tattggattactgcaatcttttattttctagcttttatagtctatagtttatacatgttagacttcttgtattatgctccacgttatccaggaagatttg |
404 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22644904 |
tattggattactgcaatcttttattttctagcttttatagtctatagtttatacatgttagacttcttgtattatgctccacgttatccaggaagatttg |
22645003 |
T |
 |
| Q |
405 |
gcattttcaattctgattgtgtgtggattggtgaaactccttgttgtatttctgtcttggcattcgatttgatgtcaaacagatataacttttcaacttc |
504 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22645004 |
gcattttcaattctgattgtgtgtggattggtgaaactcctagttgtatttctgtcttggcattcgatttgatgtcaaacagatataacttttcaacttc |
22645103 |
T |
 |
| Q |
505 |
aaaataaatgttcctttt |
522 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
22645104 |
aaaataaatgttcctttt |
22645121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University