View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17844_low_25 (Length: 397)
Name: NF17844_low_25
Description: NF17844
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17844_low_25 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 21 - 205
Target Start/End: Original strand, 36129087 - 36129271
Alignment:
| Q |
21 |
attaggttgaacttggagtggcaattggtgatgttgagaaggatggttttgttgattataaggatcaaaaggagggaaggtattgtttggtgttgaaaga |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36129087 |
attaggttgaacttggagtggcaattggtgatgttgagaaggatggttttgttgattataaggatcaaaaggagggaaggtattgtttggtgttgaaaga |
36129186 |
T |
|
| Q |
121 |
gggaaaggtaagtgaagaggtagtgatgatgaagaagttcttggagttatgaattggtggaattggtcagggactccatcataca |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36129187 |
gggaaaggtaagtgaagaggtagtgatgatgaagaagttcttggagttatgaattggtggaattggtcagggactccatcataca |
36129271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 232 - 388
Target Start/End: Original strand, 36129302 - 36129458
Alignment:
| Q |
232 |
aaagactaaagaatacgctctcaactttacactaactcttcaattcaattcctatgctcactgtaaattaaatgagcaaaatgatatacaagcaaagcaa |
331 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36129302 |
aaagactaaagaatacgctctcaactttacactaactcttcaattcaattcctatgctcactgtaaattaaatgagcaaaatgatatacaagcaaagcaa |
36129401 |
T |
|
| Q |
332 |
ctttacaaaaccctctacccttctctctatctatctatttctctgttttgtctctgc |
388 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36129402 |
ctttacaaaaccctctacccttctctctatctatctatttctctgttttgtctctgc |
36129458 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University