View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17844_low_48 (Length: 260)
Name: NF17844_low_48
Description: NF17844
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17844_low_48 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 19 - 237
Target Start/End: Original strand, 34857146 - 34857364
Alignment:
| Q |
19 |
cataggtaggctgcataacagttaccaactttaatagtcaagggatattcatattatagaactgttagtgattactattgcatatattccacccccttct |
118 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
34857146 |
cataggtaggctgcataacagttacaaactttaatagtcaagggatattcatattatagaactgttagggattactattgcatatattccacccccttct |
34857245 |
T |
 |
| Q |
119 |
ccttttgaagggcacaacagaggaaaaagttgtccaacatcatccagagaccgcgattctttaaatgtctatttatttcatctatacaactgtgtatatg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34857246 |
ccttttgaagggcacaacagaggaaaaagttgtccaacatcatccagagaccgcgattctttaaatgtctatttatttcatctatacaactgtgtatatg |
34857345 |
T |
 |
| Q |
219 |
atacttctgaccttcatct |
237 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
34857346 |
atacttctgaccttcatct |
34857364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University