View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17844_low_53 (Length: 242)
Name: NF17844_low_53
Description: NF17844
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17844_low_53 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 15 - 227
Target Start/End: Complemental strand, 32788304 - 32788092
Alignment:
| Q |
15 |
cataggtttgctatgcctccattggaggtggaggaatttcctcaagttggaatacctcaccagacacaacaaggaagcagaactacaaatgatatcatgc |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
32788304 |
cataggtttgctatgcctccattggaggtggaggaatttcctcaagttggaatacctcaccagacacaacaaggaagcagaactagaaatgatatcatgc |
32788205 |
T |
 |
| Q |
115 |
agggaattctttcacttactcatgcttctcagggattgatgaaccagttcagttattcacaagccttggatcacaatgaaaattatgctccttatgaaga |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
32788204 |
agggaattctttcacttactcatgcttctcagggattgatgaaccagtccagttattcacaagccttggatcacaatgacaattatgctccttatgaaga |
32788105 |
T |
 |
| Q |
215 |
tgattttactttc |
227 |
Q |
| |
|
||||||||||||| |
|
|
| T |
32788104 |
tgattttactttc |
32788092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University