View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17844_low_57 (Length: 238)

Name: NF17844_low_57
Description: NF17844
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17844_low_57
NF17844_low_57
[»] chr2 (1 HSPs)
chr2 (17-229)||(4851551-4851763)


Alignment Details
Target: chr2 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 17 - 229
Target Start/End: Complemental strand, 4851763 - 4851551
Alignment:
17 gtttggttatgtggccgatcaaccaaaatcacgacaagatttcacgtcaacatagaagcttagatttgtagcttcagggttttcacgacaaatatgcatt 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4851763 gtttggttatgtggccgatcaaccaaaatcacgacaagatttcacgtcaacatagaagcttagatttgtagcttcagggttttcacgacaaatatgcatt 4851664  T
117 gaaacacaacacacaaattcaagatagcaccatgcatgtgtgtgcactcaaaacccttacctaattgccactagtatttgagaccaatggagtaataata 216  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4851663 gaaacacaacacacaagttcaagatagcaccatgcatgtgtgtgcactcaaaacccttacctaattgccactagtatttgagaccaatggagtaataata 4851564  T
217 tcttccttcttat 229  Q
    |||||| ||||||    
4851563 tcttccctcttat 4851551  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University