View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17844_low_62 (Length: 226)
Name: NF17844_low_62
Description: NF17844
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17844_low_62 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 114; Significance: 6e-58; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 1 - 177
Target Start/End: Complemental strand, 25986075 - 25985901
Alignment:
| Q |
1 |
ttgcatagaactcatacgatgtgtataagacaactttttatagttgttaaaatatcatcactctttgtttaatttcgtcggtcgcctctcatccaaacat |
100 |
Q |
| |
|
||||||||||||||| | |||| |||||||||| ||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
25986075 |
ttgcatagaactcat--ggtgtgcataagacaaccttttatagttgttaaaatatcatcactctttatttaatttcgtcagtcgcctctcatccaaacat |
25985978 |
T |
|
| Q |
101 |
gcataatgaatgtctcactaaattgannnnnnnnacttgtgagaatattttcaattaggtaatgagaaaaaagcata |
177 |
Q |
| |
|
||||||||||||||||| | |||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25985977 |
gcataatgaatgtctcaatgaattgattttttttacttgtgagaatattttcaattaggtaatgagaaaaaagcata |
25985901 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University