View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17844_low_64 (Length: 225)
Name: NF17844_low_64
Description: NF17844
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17844_low_64 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 26 - 206
Target Start/End: Complemental strand, 48857599 - 48857419
Alignment:
| Q |
26 |
atatagaatacattcaccgtaagagtgtattgctgcctaggctaagcttaattcaggtgttgttgagggcgagggatcccagattgggtgtaaagnnnnn |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48857599 |
atatagaatacattcaccgtaagagtgtattgctgcctaggctaggcttaattcaggtgttgttgagggcgagggatcccagattgggtgtaaagaaaaa |
48857500 |
T |
|
| Q |
126 |
nntaggttattcatagttcttttagaatcaaggttggaaaacttatcatttgattttaaaatctttgtggtgattatatca |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48857499 |
aataggttattcatagttcttttagaatcaaggttggaaaacttatcatttgattttaaaatctttgtggtgattatatca |
48857419 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University