View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17844_low_68 (Length: 214)
Name: NF17844_low_68
Description: NF17844
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17844_low_68 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 198; Significance: 1e-108; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 198
Target Start/End: Original strand, 20551105 - 20551302
Alignment:
| Q |
1 |
attggccgtatcttcagcctcaaccataaattcaaacaaataaaccattaattataactatcagtgtgatgtgggtttagattttttaaaccctaatcag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20551105 |
attggccgtatcttcagcctcaaccataaattcaaacaaataaaccattaattataactatcagtgtgatgtgggtttagattttttaaaccctaatcag |
20551204 |
T |
|
| Q |
101 |
accacccggttcaaccggtcagaccgtgagttggattggcagtgtctcaagtcagatcactcgtcaaccataaattcaaacaatcaaaccgttgacta |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20551205 |
accacccggttcaaccggtcagaccgtgagttggattggcagtgtctcaagtcagatcactcgtcaaccataaattcaaacaatcaaaccgttgacta |
20551302 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 83 - 134
Target Start/End: Original strand, 20551058 - 20551109
Alignment:
| Q |
83 |
tttttaaaccctaatcagaccacccggttcaaccggtcagaccgtgagttgg |
134 |
Q |
| |
|
|||| |||||||||||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
20551058 |
ttttaaaaccctaatcaaaccacccggttcaaccggtcagaccgtgaattgg |
20551109 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University