View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17845_high_4 (Length: 214)
Name: NF17845_high_4
Description: NF17845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17845_high_4 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 214
Target Start/End: Complemental strand, 41641068 - 41640855
Alignment:
| Q |
1 |
ttctcggtggcatcggttaaggcttcaaaggcgtgtggaccccacaacnnnnnnncaaggtcaaaggatttgtttctttcaagggttaatgtgtggaaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41641068 |
ttctcggtggcatcggttaaggcttcaaaggcgtgtggaccccacaactttttttcaaggtcaaaggatttgtttctttcaagggttaatgtgtggaaag |
41640969 |
T |
|
| Q |
101 |
aaccagcggcgacatgttgattggattcaaggttgcgaccgtgaactcgaacggtagaagagtctttgtgaaagtcacgacacgtgactttgagatgaag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41640968 |
aaccagcggcgacatgttgattggattcaaggttgcgaccgtgaacgcgaagggtagaagagtctttgtgaaagtcacgacacgtgactttgagatgaag |
41640869 |
T |
|
| Q |
201 |
ggtgagtttaacac |
214 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
41640868 |
ggtgagtttaacac |
41640855 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University