View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17846_high_10 (Length: 254)
Name: NF17846_high_10
Description: NF17846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17846_high_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 19 - 230
Target Start/End: Original strand, 36026097 - 36026308
Alignment:
| Q |
19 |
ctcttgtgggttcttgctttacgaaatccgacacaatatttttccccggttctcttattcttttattaattctcttcattcaactatggttttactgtca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
36026097 |
ctcttgtgggttcttgctttacgaaatccgacacaatatttttccccggttctcttattcttttattaattctcttcattcaactatggtcttactgtca |
36026196 |
T |
 |
| Q |
119 |
gttgatatttaataagaggacgttctagtactatcnnnnnnnnnnnnntaagaggacgttccagaatatgatatttttccacaaatgcttctggtaatgt |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36026197 |
gttgatatttaataagaggacgttctagtactatcaaaaaaataaaaataagaggacgttccagaatatgatatttttccacaaatgcttctggtaatgt |
36026296 |
T |
 |
| Q |
219 |
agtatggagata |
230 |
Q |
| |
|
|||||||||||| |
|
|
| T |
36026297 |
agtatggagata |
36026308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University