View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17846_high_12 (Length: 242)
Name: NF17846_high_12
Description: NF17846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17846_high_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 64; Significance: 4e-28; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 58 - 170
Target Start/End: Complemental strand, 3461014 - 3460907
Alignment:
| Q |
58 |
ctaattaaccgctttgttattttgttatgtatccctggacttattataattgcattatattatactcacagccaagcatacannnnnnncacgttgaaat |
157 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| | ||||||||| |
|
|
| T |
3461014 |
ctaattaaccgctttgttattttgttatgtatccctggacttattataattgcat-----tatactcacagccaagcatacatttttttcccgttgaaat |
3460920 |
T |
 |
| Q |
158 |
atgtagacgcatg |
170 |
Q |
| |
|
|||||||| |||| |
|
|
| T |
3460919 |
atgtagacacatg |
3460907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 26091280 - 26091244
Alignment:
| Q |
1 |
ccatgggtaccctagttgtcaccattagttaataatt |
37 |
Q |
| |
|
||||||||||||||||||||||||| | ||||||||| |
|
|
| T |
26091280 |
ccatgggtaccctagttgtcaccatcatttaataatt |
26091244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 33
Target Start/End: Original strand, 26277337 - 26277369
Alignment:
| Q |
1 |
ccatgggtaccctagttgtcaccattagttaat |
33 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |
|
|
| T |
26277337 |
ccatgggtaccctagttgtcaccattatttaat |
26277369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University