View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17846_high_14 (Length: 210)

Name: NF17846_high_14
Description: NF17846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17846_high_14
NF17846_high_14
[»] chr4 (1 HSPs)
chr4 (18-85)||(25623378-25623445)


Alignment Details
Target: chr4 (Bit Score: 64; Significance: 4e-28; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 18 - 85
Target Start/End: Complemental strand, 25623445 - 25623378
Alignment:
18 tatagtacatgagaacgatctttgtgagcaaatttgagtcacatattagaaaataaaatataagtctc 85  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
25623445 tatagtacatgagaacgatctttgtgagcaaatttgagtcacatactagaaaataaaatataagtctc 25623378  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University