View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
	Query
	Query hiting target	Query hiting target's complemental strand
	Query's complemental strand hiting target	Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17846_low_13 (Length: 266)

Name: NF17846_low_13

Description: NF17846

Algorithm: BLASTN 2.2.26 [Sep-21-2011]

Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF17846_low_13

[»] chr1 (1 HSPs)

[»] chr4 (1 HSPs)

Target: chr1 (Bit Score: 95; Significance: 1e-46; HSPs: 1)

Name: chr1

Description:

Target: chr1; HSP #1

Raw Score: 95; E-Value: 1e-46

Query Start/End: Original strand, 154 - 256

Target Start/End: Original strand, 48754210 - 48754312

Alignment:

Q	154	ggttaaggtttgacagttcatatttatgataaagctttgttaggttgctctagcagaaatttgaattatgattctcttgtttgtattaactacatatgat	253	Q
		\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|
T	48754210	ggttaagttttgacagttcatatttatgataaggctttgttaggttgctctagcagaaatttgaattatgattctcttgtttgtattaactacatatgat	48754309	T

Q	254	gat	256	Q
		\|\|\|
T	48754310	gat	48754312	T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)

Name: chr4

Description:

Target: chr4; HSP #1

Raw Score: 43; E-Value: 0.000000000000002

Query Start/End: Original strand, 163 - 236

Target Start/End: Original strand, 35914347 - 35914421

Alignment:

Q	163	ttgacagttcatatttatgataaagctttgttaggttgctctagcagaaatttgaattatg-attctcttgtttg	236	Q
		\|\|\|\|\|\|\|\|\| \| \|\|\|\| \| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\| \|\|\|\|\|
T	35914347	ttgacagttaacatttcttataaagctttgttaggttgctctagcagatatttgaattatgaattctctcgtttg	35914421	T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]