View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17847_high_31 (Length: 201)
Name: NF17847_high_31
Description: NF17847
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17847_high_31 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 16 - 201
Target Start/End: Original strand, 55016951 - 55017136
Alignment:
| Q |
16 |
tattctggcagatgctagtgtggagttttacacggcttggttgtcagaaaatccaaatacctggaaggatccggatgtgtttcgacccgagaggtttttg |
115 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55016951 |
tattccggcagatgctagtgtggagttttacacggcttggttgtcagaaaatccaaatacctggaaggatccggatgtgtttcgacccgagaggtttttg |
55017050 |
T |
 |
| Q |
116 |
aatggggatggggttgatgttgatattacaggaactaaagagatgaagatgatgccgtttggagctgggaggaggatttgtccagc |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
55017051 |
aatggggatggggttgatgttgatattacaggaactaaagagatgaagatgatgccgtttggtgctgggaggaggatttgtccagc |
55017136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 44; Significance: 3e-16; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 135 - 198
Target Start/End: Original strand, 41127291 - 41127354
Alignment:
| Q |
135 |
ttgatattacaggaactaaagagatgaagatgatgccgtttggagctgggaggaggatttgtcc |
198 |
Q |
| |
|
|||||||||| || ||||||||||| ||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
41127291 |
ttgatattaccgggactaaagagataaagatgatgccgtttggagttgggaggagaatttgtcc |
41127354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 152 - 198
Target Start/End: Original strand, 26494893 - 26494939
Alignment:
| Q |
152 |
aaagagatgaagatgatgccgtttggagctgggaggaggatttgtcc |
198 |
Q |
| |
|
|||||||| |||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
26494893 |
aaagagataaagatgatgccgtttggagcagggaggaggatttgtcc |
26494939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 44; Significance: 3e-16; HSPs: 5)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 135 - 198
Target Start/End: Original strand, 2327264 - 2327327
Alignment:
| Q |
135 |
ttgatattacaggaactaaagagatgaagatgatgccgtttggagctgggaggaggatttgtcc |
198 |
Q |
| |
|
||||||||||||| | ||||||||| ||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
2327264 |
ttgatattacagggagtaaagagatcaagatgatgccgtttggagctggtaggagaatttgtcc |
2327327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 135 - 198
Target Start/End: Original strand, 2330979 - 2331042
Alignment:
| Q |
135 |
ttgatattacaggaactaaagagatgaagatgatgccgtttggagctgggaggaggatttgtcc |
198 |
Q |
| |
|
|||| |||||||||| ||||||||| ||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
2330979 |
ttgacattacaggaagtaaagagataaagatgatgccatttggagctgggaggagaatttgtcc |
2331042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 135 - 198
Target Start/End: Original strand, 2294096 - 2294159
Alignment:
| Q |
135 |
ttgatattacaggaactaaagagatgaagatgatgccgtttggagctgggaggaggatttgtcc |
198 |
Q |
| |
|
|||| |||||||||| ||||||||| ||||||||||||||||||||||| || || |||||||| |
|
|
| T |
2294096 |
ttgacattacaggaagtaaagagataaagatgatgccgtttggagctggaagaagaatttgtcc |
2294159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 135 - 198
Target Start/End: Original strand, 2321411 - 2321474
Alignment:
| Q |
135 |
ttgatattacaggaactaaagagatgaagatgatgccgtttggagctgggaggaggatttgtcc |
198 |
Q |
| |
|
||||||||| ||| | ||||||||| ||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
2321411 |
ttgatattatagggagtaaagagataaagatgatgccgtttggagctggaaggagaatttgtcc |
2321474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 144 - 198
Target Start/End: Original strand, 2310436 - 2310490
Alignment:
| Q |
144 |
caggaactaaagagatgaagatgatgccgtttggagctgggaggaggatttgtcc |
198 |
Q |
| |
|
|||||| ||||||||| ||||||||||||||||||||||| || || |||||||| |
|
|
| T |
2310436 |
caggaagtaaagagataaagatgatgccgtttggagctggaagaagaatttgtcc |
2310490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University