View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17847_low_26 (Length: 226)
Name: NF17847_low_26
Description: NF17847
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17847_low_26 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 106; Significance: 3e-53; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 103 - 212
Target Start/End: Original strand, 13519258 - 13519367
Alignment:
| Q |
103 |
tgatgatgagggttaaggagcatgaagttgaaccattcatcaaaaagatttgattgaggatctgtcatagtgtgaatgttagtttgatattgtaaaggct |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13519258 |
tgatgatgagggttaaggagcatgaagttgaaccattcatcaaaaagatttgattgaggatctgtcatagtgtgaatgttagtttgatattgtaaaggct |
13519357 |
T |
|
| Q |
203 |
atattcttgg |
212 |
Q |
| |
|
||||| |||| |
|
|
| T |
13519358 |
atattattgg |
13519367 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 103 - 212
Target Start/End: Original strand, 13608791 - 13608900
Alignment:
| Q |
103 |
tgatgatgagggttaaggagcatgaagttgaaccattcatcaaaaagatttgattgaggatctgtcatagtgtgaatgttagtttgatattgtaaaggct |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13608791 |
tgatgatgagggttaaggagcatgaagttgaaccattcatcaaaaagatttgattgaggatctgtcatagtgtgaatgttagtttgatattgtaaaggct |
13608890 |
T |
|
| Q |
203 |
atattcttgg |
212 |
Q |
| |
|
||||| |||| |
|
|
| T |
13608891 |
atattattgg |
13608900 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 20 - 74
Target Start/End: Original strand, 13519181 - 13519235
Alignment:
| Q |
20 |
gattcatggtggaagatgaggaggagggttgaatttcaaacatgttggtttggtg |
74 |
Q |
| |
|
||||||||| ||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13519181 |
gattcatggaggaggatgaggaggagggttgaatttcaaacatgttggtttggtg |
13519235 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 20 - 74
Target Start/End: Original strand, 13608714 - 13608768
Alignment:
| Q |
20 |
gattcatggtggaagatgaggaggagggttgaatttcaaacatgttggtttggtg |
74 |
Q |
| |
|
||||||||| ||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13608714 |
gattcatggaggaggatgaggaggagggttgaatttcaaacatgttggtttggtg |
13608768 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University