View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17847_low_27 (Length: 221)
Name: NF17847_low_27
Description: NF17847
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17847_low_27 |
 |  |
|
| [»] scaffold0318 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0318 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: scaffold0318
Description:
Target: scaffold0318; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 20 - 202
Target Start/End: Complemental strand, 15504 - 15322
Alignment:
| Q |
20 |
atgaggtgtctttatcatcttttccaacactatgatcaaatttgcatagtgtaaagccagagctgaagcacctaaagtactaggaggtggtttcaaaagc |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15504 |
atgaggtgtctttatcatcttttccaacactatgatcaaatttgcatagtgtaaagccaaagctgaagcacctaaagtactaggaggtggtttcaaaagc |
15405 |
T |
 |
| Q |
120 |
tttgaatttgactcaaaaaacccacttcccaatcctaaaccatccttgatcacatcaagctctgggctttccaatgacccaga |
202 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15404 |
tttgaatttgactcaaaaaacccagttcccaatcctaaaccatccttgatcacatcaagctctgggctttccaatgacccaga |
15322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University