View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17848_high_1 (Length: 267)
Name: NF17848_high_1
Description: NF17848
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17848_high_1 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 13 - 249
Target Start/End: Complemental strand, 33819641 - 33819406
Alignment:
| Q |
13 |
aaaatacaatttttgttttcaatatatgacactcgtgtcaattgttttgtttccgaaactctcatgaaaatatcaatgacggtcagttgcagtcttgggg |
112 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33819641 |
aaaatacaatttt-gttttcaatatatgacactcgtgtcatttgttttgtttccgaaactctcatgaaaatatcaatgacggtcagttgcagtcttgggg |
33819543 |
T |
 |
| Q |
113 |
aagaatggtaaataacattagacaaatcctaaataggttttagaacattaagtttcaatttactaaaccttgtaataatatggtatagctctggctcata |
212 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33819542 |
aagaatggtaaataacattagacaaaccctaaataggttttagaacattaagtttcaatttactaaaccttgtaataatatggtatagctctggctcata |
33819443 |
T |
 |
| Q |
213 |
tactatagccaagcatgcccatatagagggggtataa |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33819442 |
tactatagccaagcatgcccatatagagggggtataa |
33819406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University