View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1784_low_6 (Length: 232)
Name: NF1784_low_6
Description: NF1784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1784_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 13 - 217
Target Start/End: Complemental strand, 35773175 - 35772971
Alignment:
| Q |
13 |
attatactataaagatcagaccattcaaaaaaggaacatagagaagatatgattagtgtcaatgttcaattatttattaaacttatggaacaaatgcaca |
112 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35773175 |
attaaactataaagatcagaccattcaaaaaaggaacatagagaagatatgattagtgtcaatgttcaattatttattaaacttatggaacaaatgcaca |
35773076 |
T |
|
| Q |
113 |
tgacatgcaaatatgtgttttgcatatacatacccttagggaattcttcttgttattatttggaggatgatcagaaggcagaggaggagtttttgaagtt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35773075 |
tgacatgcaaatatgtgttttgcatatacatacccttagggaattcttcttgttattatttggaggatgatcagaaggcagaggaggagtttttgaagtt |
35772976 |
T |
|
| Q |
213 |
gcatt |
217 |
Q |
| |
|
||||| |
|
|
| T |
35772975 |
gcatt |
35772971 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University