View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17852_high_16 (Length: 274)
Name: NF17852_high_16
Description: NF17852
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17852_high_16 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 1 - 256
Target Start/End: Original strand, 2331705 - 2331957
Alignment:
| Q |
1 |
caacaatgatcaccaccaataatggtgaaaaacagttaaaagggaaaaccaacacaagaaaggagaatacttaggtatcgttccctgcacactattcgct |
100 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
2331705 |
caacaatgatcaccaccaat---ggtgaaaaacagttaaaagggaaaaccaacacaagaaaggagaatacttaggtatcgttccctacacactattcgct |
2331801 |
T |
 |
| Q |
101 |
cagttcttcacatgaatgtacctaaacattgtcgtttaaaaatgatttggattaatggcggttgggcagttttaataatttattttgtaactaaagttat |
200 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2331802 |
cagtttttcacatgaatgcacctaaacattgtcgtttaaaaatgatttggattaatggcggttgggcagttttaataatttattttgtaactaaagttat |
2331901 |
T |
 |
| Q |
201 |
gaaccggatgaacactagctattcgaagaactgcacataagtatttttgcaagaga |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2331902 |
gaaccggatgaacactagctattcgaagaactgcacataagtatttttgcaagaga |
2331957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University