View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17852_high_30 (Length: 218)
Name: NF17852_high_30
Description: NF17852
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17852_high_30 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 19 - 189
Target Start/End: Original strand, 36887729 - 36887898
Alignment:
| Q |
19 |
attagataatcaagattcaactgtgataatccagattctagaacaattatcgaagttaccttcaggtgaatgagttaacgcccaagctctgagaaatcaa |
118 |
Q |
| |
|
|||||| |||||||||||||| ||||||||||||||||| ||| ||||||||||||||||||| | |||||||||||||||| ||||||||||||||||| |
|
|
| T |
36887729 |
attagaaaatcaagattcaacagtgataatccagattctggaaaaattatcgaagttaccttcggctgaatgagttaacgcc-aagctctgagaaatcaa |
36887827 |
T |
 |
| Q |
119 |
aattgaggagaagagaaccagattgagaagcaggtaaaggaagttacgaatcatttttctgagaattggaa |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36887828 |
aattgaggagaagagaaccagattgagaagcaggtaaaggaagttacgaatcatttttctgagaattggaa |
36887898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University