View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17852_low_19 (Length: 289)
Name: NF17852_low_19
Description: NF17852
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17852_low_19 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 139; Significance: 9e-73; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 139; E-Value: 9e-73
Query Start/End: Original strand, 140 - 278
Target Start/End: Original strand, 404788 - 404926
Alignment:
| Q |
140 |
atcacaaatagaatgtttgtaatatttgcacggatatgagtttttaatacatgtcctatttgataacttttcattctttttcaattagcaccaatatgag |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
404788 |
atcacaaatagaatgtttgtaatatttgcacggatatgagtttttaatacatgtcctatttgataacttttcattctttttcaattagcaccaatatgag |
404887 |
T |
|
| Q |
240 |
catgttgtgctattgtcactgagctaacaattgcttcat |
278 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
404888 |
catgttgtgctattgtcactgagctaacaattgcttcat |
404926 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 140 - 278
Target Start/End: Complemental strand, 973049 - 972907
Alignment:
| Q |
140 |
atcacaaatagaatgtttgtaatatttgcacggatatgagtttttaatacatgtcctatttgataacttttcattctttttcaa----ttagcaccaata |
235 |
Q |
| |
|
|||||||| |||| |||||||||||| |||| ||||||||||| || ||||||| ||||||| ||||||||||| | ||| || |||| ||||||| |
|
|
| T |
973049 |
atcacaaacagaaagtttgtaatattagcacctatatgagttttgaaaacatgtcttatttgagaacttttcattatcttttaattagttaggaccaata |
972950 |
T |
|
| Q |
236 |
tgagcatgttgtgctattgtcactgagctaacaattgcttcat |
278 |
Q |
| |
|
|||||||||||| | || |||||||| |||||||| |||||| |
|
|
| T |
972949 |
cgagcatgttgtgttgttatcactgaggtaacaatttcttcat |
972907 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University