View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17852_low_23 (Length: 254)
Name: NF17852_low_23
Description: NF17852
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17852_low_23 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 17 - 247
Target Start/End: Complemental strand, 2766051 - 2765821
Alignment:
| Q |
17 |
aatactttccgttgaagatcgagttggtccgggaaaagatgagatcattgggagggttatcataccgctgaacgctgtggagaggcgcgcggatgataga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2766051 |
aatactttccgttgaagatcgagttggtccgggaaaagatgagatcattgggagggttatcataccgctgaacgctgtggagaggcgcgcggatgataga |
2765952 |
T |
|
| Q |
117 |
atcattcattctagatggttcaacttagaaaagcctgttgccgtggatgttgatcagctgaagagagaaaagtttgcaagcagaattcagctacggctat |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2765951 |
atcattcattctagatggttcaacttagaaaagcctgttgccgtggatgttgatcagctgaagagagaaaagtttgcaagcagaattcagctacggctat |
2765852 |
T |
|
| Q |
217 |
gtctggatggaggatatcatgttcttgatga |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
2765851 |
gtctggatggaggatatcatgttcttgatga |
2765821 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University