View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17852_low_26 (Length: 250)
Name: NF17852_low_26
Description: NF17852
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17852_low_26 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 68 - 250
Target Start/End: Complemental strand, 386980 - 386798
Alignment:
| Q |
68 |
ggtggcacaattcctccgcttccaacactccaaatatgctattatagacaaatcgtatggcattctaaagcaggtttcacactagcagtatgttatttat |
167 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
386980 |
ggtggcacaattcctccgcttccaacactccaaatatgctattatagacaaatcgtatggcattctaaagcaggtttcacactagcagtatgttatttat |
386881 |
T |
 |
| Q |
168 |
aaatgttaaagataaagcaaacattataaagttgtttttataagtcacttaaccaaagaagtaaagtaaatgttagatataat |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
386880 |
aaatgttaaagataaagcaaacattataaagttgtttttataagtcacttaaccaaagaagtaaagtaaatgttagatataat |
386798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University