View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17852_low_30 (Length: 239)
Name: NF17852_low_30
Description: NF17852
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17852_low_30 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 18 - 239
Target Start/End: Complemental strand, 6863406 - 6863185
Alignment:
| Q |
18 |
caaacgtatgtataacttgccatgcctctctatagacatgtttctatgctcttagacataactaaaacactccataaacttgatttgcttatttcataac |
117 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6863406 |
caaacgtatgtacaacttgccatgcctctctatagacatgtttctatgctcttagacatagctaaaacactccataaacttgatttgcttatttcataac |
6863307 |
T |
 |
| Q |
118 |
catttcaatgaagtttagccttttgtcaaggctttatggcttatagaaatcatttaactgaaatagtatttagtttctaattcataaagaccttataagt |
217 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6863306 |
catttcaatgaagtttagctttttgtcaaggctttatggcttatagaaatcatttaactgaaatagtatttagtttctaattcataaagaccttataagt |
6863207 |
T |
 |
| Q |
218 |
ttaggctttgtctaacatgcac |
239 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
6863206 |
ttaggctttgtctaacatgcac |
6863185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University