View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17852_low_34 (Length: 227)
Name: NF17852_low_34
Description: NF17852
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17852_low_34 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 7 - 225
Target Start/End: Complemental strand, 40242239 - 40242023
Alignment:
| Q |
7 |
taaacaaactaaatcttttggaatgcatgaaatatccaaaattgaa-tttgctcatttcctattatgcactcaaggtggtgaaaaataattaggtcatct |
105 |
Q |
| |
|
|||||||||||||| |||||||||| |||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||| | |||| | |
|
|
| T |
40242239 |
taaacaaactaaattttttggaatggatgaaatatccaaaattgaaatttgctcatttcctat---gcactcaaggtggtgaaaaataatttgctcatat |
40242143 |
T |
 |
| Q |
106 |
ccttttaatattattttttaaaaagaataaattaaacaacccagtatcttgatgatgtacacaatgacataagaatgatgaataatcaaaagtctttcta |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
40242142 |
ccttttaatattattttttaaaaagaataaattaaacaacccaatatcttcatgatgtacacaatgacataagaatgatcaataatcaaaagtctttcta |
40242043 |
T |
 |
| Q |
206 |
gtttgtgcttaattgaacgt |
225 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
40242042 |
gtttgtgcttaattgaacgt |
40242023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University