View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17853_low_17 (Length: 269)
Name: NF17853_low_17
Description: NF17853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17853_low_17 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 15 - 269
Target Start/End: Original strand, 43395037 - 43395292
Alignment:
| Q |
15 |
caaagggtcactaaacctacnnnnnnngatggcagagacactacgtagggaagaaccaccacctgacctaacagatttcatgaatgacatgttttttggg |
114 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43395037 |
caaagggtcactaaacctacaaaaaaagatggcagagacactacgtagggaagaaccaccacctgacctaacagatttcatgaatgacatgttttttggg |
43395136 |
T |
|
| Q |
115 |
acagtggacactcaccagaaaacctatgacctcactggtggggttggtatgaacatggatgatgatgaggaagatgatgg-ttcgatgatagtactagaa |
213 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
43395137 |
acagtagacactcaccagaaaacctatgacctcactggtggggttggtatgaacatggatgatgatgaggaagatgatggtttcgatgatagtactagaa |
43395236 |
T |
|
| Q |
214 |
gtaacagtgcaaggttaacacaagaatggttgcaagaagcaagactcgtcgttgct |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43395237 |
gtaacagtgcaaggttaacacaagaatggttgcaagaagcaagactcgtcgttgct |
43395292 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University