View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17853_low_20 (Length: 250)
Name: NF17853_low_20
Description: NF17853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17853_low_20 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 30
Target Start/End: Complemental strand, 34130107 - 34130078
Alignment:
| Q |
1 |
tatgtgacgtggaatgctatttatatcatg |
30 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
34130107 |
tatgtgacgtggaatgctatttatatcatg |
34130078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University