View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17854_low_8 (Length: 377)
Name: NF17854_low_8
Description: NF17854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17854_low_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 153; Significance: 5e-81; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 153; E-Value: 5e-81
Query Start/End: Original strand, 3 - 179
Target Start/End: Original strand, 8771600 - 8771775
Alignment:
| Q |
3 |
acctaataccacaataccatgagccaccaccaacaccgccatcgaccgacaatcacatgatattttggtggcgggccttctgatttatctccactgcata |
102 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||| | |||||||||||||||||||||||||| ||||| |
|
|
| T |
8771600 |
acctaataccacactaccatgagccaccaccaacaccgccatcgaccgacaatcgcatgatatttcg-tggcgggccttctgatttatctccacggcata |
8771698 |
T |
|
| Q |
103 |
atttctctcagcacatcgccgccaagattaggatgggaaaattaagtacaattattttcaatatcttggtcttatat |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8771699 |
atttctctcagcacatcgccgccaagattaggatgggaaaattaagtacaattattttcaatatcttggtcttatat |
8771775 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 236 - 362
Target Start/End: Original strand, 8771833 - 8771958
Alignment:
| Q |
236 |
gggacgctagcaacaactctgatgcttcaaccatgacaagaagatagttgacttgccatgaccatcacatcatctataatgggttcggaatgttgtgggt |
335 |
Q |
| |
|
||||||| ||||||||||||||||| |||||||||||| |||||||||| ||||||||||||||||| || || |||||||||||||||||||||||| |
|
|
| T |
8771833 |
gggacgcgagcaacaactctgatgcatcaaccatgacaggaagatagttaacttgccatgaccatca-atgatagttaatgggttcggaatgttgtgggt |
8771931 |
T |
|
| Q |
336 |
gctttcggtcttcatccacttcttttt |
362 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
8771932 |
gctttcggtcttcatccacttcttttt |
8771958 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 121 - 177
Target Start/End: Complemental strand, 16963585 - 16963529
Alignment:
| Q |
121 |
ccgccaagattaggatgggaaaattaagtacaattattttcaatatcttggtcttat |
177 |
Q |
| |
|
||||||| ||| ||||| || || |||||||||||||||| |||||||||||||||| |
|
|
| T |
16963585 |
ccgccaaaatttggatgagagaagtaagtacaattattttaaatatcttggtcttat |
16963529 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University