View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17855_high_16 (Length: 268)
Name: NF17855_high_16
Description: NF17855
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17855_high_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 222; Significance: 1e-122; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 250
Target Start/End: Original strand, 45103717 - 45103966
Alignment:
| Q |
1 |
taaaccttgttttaactttttaactaactgtcattattacaataggaaatggttgatgtagagaatatgcaagggcaatattgtcatcaaacaagtactg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45103717 |
taaaccttgttttaactttttaactaactgtcattattacaataggaaatggttgatgtagagaatatgcaagggcaatattgtcatcaaacaagtactg |
45103816 |
T |
 |
| Q |
101 |
atgatgaagaagagttcttgagagacataattcttcagcaacctgttgcatattctggaagcagtttatcatcttctagtgagatggacggttcagatag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45103817 |
atgatgaagaagagttcttgagagacataattcttcagcaacctgttacatattctggaagcagtttatcatcttctagtgagatggacggttcagatag |
45103916 |
T |
 |
| Q |
201 |
ctcggggaaaaagcttcatccttcatcatcaccgttcactccaaggacat |
250 |
Q |
| |
|
|||||||||||| ||||||| || |||| |||| | |||||||||||||| |
|
|
| T |
45103917 |
ctcggggaaaaaacttcatcttttatcaacaccatccactccaaggacat |
45103966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 39 - 250
Target Start/End: Original strand, 45130384 - 45130592
Alignment:
| Q |
39 |
acaataggaaatggttgatgtagagaatatgcaagggcaatattgtcatcaaacaagtactgatgatgaagaagagttcttgagagacataattcttcag |
138 |
Q |
| |
|
|||||||||| ||| |||||||||| | ||| ||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
45130384 |
acaataggaattgggtgatgtagaggttttgctagggcaatattgtcatcaaactagtgctgatgatgaagaagagttcttgagagacataatccttcag |
45130483 |
T |
 |
| Q |
139 |
caacctgttgcatattctggaagcagtttatcatcttctagtgagatggacggttcagatagctcggggaaaaagcttcatccttcatcatcaccgttca |
238 |
Q |
| |
|
||||||||| ||||||||||| ||| ||||||| |||| ||||||||| || |||||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
45130484 |
caacctgttacatattctgga---agtatatcatcctctaatgagatggatggctcagattgctcaaagaaaaagcttcatccttcatcatcaccgttca |
45130580 |
T |
 |
| Q |
239 |
ctccaaggacat |
250 |
Q |
| |
|
|||||||||||| |
|
|
| T |
45130581 |
ctccaaggacat |
45130592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University