View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17855_high_18 (Length: 213)
Name: NF17855_high_18
Description: NF17855
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17855_high_18 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 18 - 196
Target Start/End: Complemental strand, 54146616 - 54146438
Alignment:
| Q |
18 |
taacagtcacagtgtattatgctagcaaaatgttggtttgtggcctgctatacaaagtcaattaattcatcgcatggttgtagcaggaaatgtctctgcc |
117 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
54146616 |
taacagtcacaatgtattatgctagcaaaatgttggtttgtggcctgctatacaaagtcaattaattcatcgtatggttgtagcaggaaatgtctctgcc |
54146517 |
T |
|
| Q |
118 |
attatgcaggttttgctacccgagcagcaggccaaactgtcatgatatggaggaatgcacaacaccgtggaaccagcct |
196 |
Q |
| |
|
|||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54146516 |
attatgcaggttttactacccaagcagcaggccaaactgtcatgatatggaggaatgcacaacaccgtggaaccagcct |
54146438 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University