View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17855_low_17 (Length: 306)
Name: NF17855_low_17
Description: NF17855
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17855_low_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 20 - 296
Target Start/End: Complemental strand, 32054652 - 32054376
Alignment:
| Q |
20 |
agcagtaacagcaaagaaaaagaaaaggcacgagtgagtcgtacctcactcatactatggcacgctcatcaaaacgacgccgctgctgttcgtaaacttc |
119 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32054652 |
agcagtaacagcaaagaaaaagaaaaagcacgagtgagtcgaacctcactcatactatggcacgctcatcaaaacgacgccgctgctgttcgtaaacttc |
32054553 |
T |
|
| Q |
120 |
ttcaagaagatccttctctcgttaacgccaccgattacgataaccgtactcctcttcacgtcgcttctcttcacggttggatcgacgttgccaattgctt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32054552 |
ttcaagaagatccttctctcgttaacgctactgattacgataaccgtactcctcttcacgtcgcttctcttcacggttggatcgacgttgccaattgctt |
32054453 |
T |
|
| Q |
220 |
gcttgaattcggcgctgatgtcaacgctcaagatcgctggaaaaacaccgtacgtaatcgcttcttcctcgcctttg |
296 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
32054452 |
gcttgaattcggcgctgatgtcaacgctcaagatcgctggaaaaacaccgtacgtaatcacttcttcctcgtctttg |
32054376 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 80; Significance: 2e-37; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 165 - 296
Target Start/End: Original strand, 5061350 - 5061481
Alignment:
| Q |
165 |
gtactcctcttcacgtcgcttctcttcacggttggatcgacgttgccaattgcttgcttgaattcggcgctgatgtcaacgctcaagatcgctggaaaaa |
264 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||||||| || | |||||||||||||||||||||||||| | |||||||||||||||| |||||||||| |
|
|
| T |
5061350 |
gtactcctcttcacgtcacttttcttcacggttggatcaacatcgccaattgcttgcttgaattcggcgccgttgtcaacgctcaagatagctggaaaaa |
5061449 |
T |
|
| Q |
265 |
caccgtacgtaatcgcttcttcctcgcctttg |
296 |
Q |
| |
|
|||| | |||||||||| |||| ||| ||||| |
|
|
| T |
5061450 |
caccatccgtaatcgctgcttcttcgtctttg |
5061481 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University