View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17855_low_21 (Length: 266)

Name: NF17855_low_21
Description: NF17855
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17855_low_21
NF17855_low_21
[»] chr5 (1 HSPs)
chr5 (12-250)||(11026193-11026432)


Alignment Details
Target: chr5 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 12 - 250
Target Start/End: Complemental strand, 11026432 - 11026193
Alignment:
12 atgaataattacgaaagacgtaaagatagtactggtaataatttcacaagtaatgaaggtgaatgtcattgaaactcgttatgatgtagttgcacaaaat 111  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11026432 atgaataattacgaaagacgtaaagatagtactggtaataatttcacaagtaatgaaggtgaatgtcattgaaactcgttatgatgtagttgcacaaaat 11026333  T
112 catgtgggt-ttacttaaaccttaaataaatcaatctgcatggtgcaaataaaacccgacgattccatgtactagacaacagtgaaattgaagaagaaaa 210  Q
    ||| || || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11026332 catatgtgtgttacttaaaccttaaataaatcaatctgcatggtgcaaataaaacccgacgattccatgtactagacaacagtgaaattgaagaagaaaa 11026233  T
211 tttactgttatgttaaggcaaaaagtaaaatccgttgatt 250  Q
    || |||||||||||||||||||||||||||||||||||||    
11026232 ttaactgttatgttaaggcaaaaagtaaaatccgttgatt 11026193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University