View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17855_low_24 (Length: 202)
Name: NF17855_low_24
Description: NF17855
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17855_low_24 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 1 - 192
Target Start/End: Original strand, 53012862 - 53013053
Alignment:
| Q |
1 |
tttgcttcttaaaagcatggtttcgggttggaattcgtacgaaaatgtttaaactaacaatatcgatatttatcgatttgagttaagttttatgaacaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
53012862 |
tttgcttcttaaaagcatggtttcaggttggaattcgtacgaaaatgtttaaactaacaatatcgatatttatcggtttgagttaagttttatgaacaaa |
53012961 |
T |
 |
| Q |
101 |
tataaagagtgaatgctatactgtaaaattatagatagcaatattttcaaccgtaacaatcattacaagattttgttattagtgagatgatg |
192 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
53012962 |
tataaagagtgaatgttgtactgtaaaattatagatagcaatattttcaaccgtaacaatcattacaagattttgttattagtgatatgatg |
53013053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University