View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17856_high_10 (Length: 219)
Name: NF17856_high_10
Description: NF17856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17856_high_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 74; Significance: 4e-34; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 28 - 159
Target Start/End: Original strand, 31462957 - 31463084
Alignment:
| Q |
28 |
gaagaaaagttaaatgtgaaatatttgtttgcttaattcgacgggttaggtatcattaattaatatgattattgctgcaccttttnnnnnnntattgtat |
127 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||| ||||||| ||||||||||| |||||||||||||||||||| |||||| |||||||| |
|
|
| T |
31462957 |
gaagaaaagttaaatgtggaatacttgtttgcttgattcgacaggttaggtatc----attaatatgattattgctgcgccttttaaaaaaatattgtat |
31463052 |
T |
 |
| Q |
128 |
tttatatcttattaaataattttaaatattac |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
31463053 |
tttatatcttattaaataattttaaatattac |
31463084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University