View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17856_high_8 (Length: 265)
Name: NF17856_high_8
Description: NF17856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17856_high_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 21 - 246
Target Start/End: Complemental strand, 190531 - 190312
Alignment:
| Q |
21 |
aatgcaaattatttgtcactttttagaaacaatacagggaaatccagtcaacataggttgcttctatgatcaatcttctactttaatttgcaggaactag |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
190531 |
aatgcaaattatttgtcactttttagaaacaatacagggaaatctagtcaacataggttgcttctatgatcaatcttctactttaatttgcaggaact-- |
190434 |
T |
|
| Q |
121 |
cagctaatccatgatatattggtatatataatgtgtgcatgtagctagaatattagatcaacgtgtcatgagattgcataacaaggttagttaaatttat |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
190433 |
-agctaatccatgatatattggtatatataatgtgtgcatgtagctag---attagatcaacgtgtcatgagattgcataacaaggttagttaaatttac |
190338 |
T |
|
| Q |
221 |
catcatacttgacttaattacctaag |
246 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
190337 |
catcatacttgacttaattacctaag |
190312 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University