View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17856_low_13 (Length: 241)
Name: NF17856_low_13
Description: NF17856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17856_low_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 5 - 203
Target Start/End: Original strand, 31463290 - 31463476
Alignment:
| Q |
5 |
attctatttgactttagccgaaccctaaattatcagagttatggtcatcttagaattgaaaagttaacatatattcatatatattgaattcaatagttta |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31463290 |
attctatttgactttagccgaaccctaaattatcagagttctggtcatctgagaattgaaaagttaacatatattcatatatattgaattcaatagttta |
31463389 |
T |
|
| Q |
105 |
atgaatcttattatgagattgttgtatgtgtgtgtgnnnnnnnnnnnnaaagatatgtttatcattgctactaagcaattagtgtgtaatactaatata |
203 |
Q |
| |
|
|||||||||||||||||||||||||| | | | | ||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
31463390 |
atgaatcttattatgagattgttgtacatatatat------------ataagatatgtttatcattgctactaaccaattagtgtgtaatactaatata |
31463476 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University