View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17856_low_7 (Length: 290)
Name: NF17856_low_7
Description: NF17856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17856_low_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 189; Significance: 1e-102; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 18 - 242
Target Start/End: Complemental strand, 8402373 - 8402149
Alignment:
| Q |
18 |
cgacaattacctatagaggttaagacaaatgaaaagtaggtgcttcacacctatactagaactggaagttgccaaaacagttgttggtggtttaaatttt |
117 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |||| | ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8402373 |
cgacaattacctatagaggtttagacaaatgaagagtatgagcttcacacctatactaaaactggaagttgccaaaacagttgttggtggtttaaatttt |
8402274 |
T |
|
| Q |
118 |
tacattagagaaaattggttgaccaacatcttgttgacttggcccaatttggagaaaaattggacaaatatcaacaacttggttgacttttaagtccatt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8402273 |
tacattagagaaaattggttgaccaacatcttgttgacttagcccaatttggagaaaaattgaacaaatatcaacatcttggttgacttttaagtccatt |
8402174 |
T |
|
| Q |
218 |
tcagcataatgtcaacaatgtcgaa |
242 |
Q |
| |
|
|||||||||| |||||||||||||| |
|
|
| T |
8402173 |
tcagcataatatcaacaatgtcgaa |
8402149 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 101 - 176
Target Start/End: Complemental strand, 8427991 - 8427915
Alignment:
| Q |
101 |
ttggtggtttaaatttttacattagagaaaa-ttggttgaccaacatcttgttgacttggcccaatttggagaaaaa |
176 |
Q |
| |
|
||||||||||| ||||||||||||||||||| ||||| | ||||||||||||||||||| |||||| ||||||||| |
|
|
| T |
8427991 |
ttggtggtttagatttttacattagagaaaaattggtcaatcaacatcttgttgacttggtccaattaggagaaaaa |
8427915 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University