View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17858_high_16 (Length: 250)
Name: NF17858_high_16
Description: NF17858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17858_high_16 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 9 - 250
Target Start/End: Original strand, 26034581 - 26034822
Alignment:
| Q |
9 |
caagaatatcggcaagtttgagaacaagaaagctataacatcctcataattcggaacactggcacgtgtcaatttaaaattaacaacnnnnnnnggcatt |
108 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
26034581 |
caagtatatcggcaagtttgagaacaagaaagctataacatcctcataattcggaacactagcacgtgtcaatttaaaattaacaactttttttggcatt |
26034680 |
T |
|
| Q |
109 |
gatccttgataatgttttgattcattatttcttaatttctcttctcttttctctcccacaccattattccataacaacgttagagtaacattgcttgata |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26034681 |
gatccttgataatgttttgattcattatttcttaatttctcttctcttttctctcccacaccattattccataacaacgttagagtaacattgcttgata |
26034780 |
T |
|
| Q |
209 |
gctatagaaggaaatatggctagctcacctgaaaactcagac |
250 |
Q |
| |
|
||||||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
26034781 |
gctatagaaggaaatatggctagctcaactgagaactcagac |
26034822 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University