View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17858_high_19 (Length: 244)
Name: NF17858_high_19
Description: NF17858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17858_high_19 |
 |  |
|
| [»] scaffold0057 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 154; Significance: 8e-82; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 11888352 - 11888572
Alignment:
| Q |
1 |
ctaaggtttgta-tcttgcaccatacatatcattcatggcattttagttgattaatctaaccgtcggaccccttcccggacactgtgtgtgcgggagctt |
99 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||| || ||||||||| | |||| |||||| ||| ||||||| |
|
|
| T |
11888352 |
ctaaggtttgtaatcttgcaccatacatatcattcatggcattttagttgattaatcgaacagtgggacccctttctggaccctgtgtatgcaggagctt |
11888451 |
T |
 |
| Q |
100 |
cagtgcaccgacttgccctttaatttaacagtgtgaattatgttttcatgtaatatatattatttgtcagatgaatctcccatcaagccttttcccgtcc |
199 |
Q |
| |
|
|||||||| | |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11888452 |
cagtgcactgggttgccctttaatttaa-----tgaattatgttttcatgtaatatatattatttgtcagatgaatctcccatcaagccttttcccgtcc |
11888546 |
T |
 |
| Q |
200 |
attgatctcacatatgttgaggataa |
225 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
11888547 |
attgatctcacatatgttgaggataa |
11888572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 65 - 120
Target Start/End: Original strand, 7879718 - 7879773
Alignment:
| Q |
65 |
ggaccccttcccggacactgtgtgtgcgggagcttcagtgcaccgacttgcccttt |
120 |
Q |
| |
|
|||||||||||||||| ||| || ||||||||||||||||||||| ||||||||| |
|
|
| T |
7879718 |
ggaccccttcccggaccctgcgtatgcgggagcttcagtgcaccgggttgcccttt |
7879773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 65 - 120
Target Start/End: Original strand, 40463956 - 40464011
Alignment:
| Q |
65 |
ggaccccttcccggacactgtgtgtgcgggagcttcagtgcaccgacttgcccttt |
120 |
Q |
| |
|
|||||||||| ||||| ||| || |||||||||||||||||||||| ||||||||| |
|
|
| T |
40463956 |
ggaccccttctcggaccctgcgtatgcgggagcttcagtgcaccgagttgcccttt |
40464011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 65 - 120
Target Start/End: Complemental strand, 38262251 - 38262196
Alignment:
| Q |
65 |
ggaccccttcccggacactgtgtgtgcgggagcttcagtgcaccgacttgcccttt |
120 |
Q |
| |
|
||||||||||||| |||||| || ||||||||||| ||||||||| ||||||||| |
|
|
| T |
38262251 |
ggaccccttcccgaacactgcgtatgcgggagctttagtgcaccggattgcccttt |
38262196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.000000000005; HSPs: 9)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 66 - 126
Target Start/End: Complemental strand, 40553991 - 40553931
Alignment:
| Q |
66 |
gaccccttcccggacactgtgtgtgcgggagcttcagtgcaccgacttgccctttaattta |
126 |
Q |
| |
|
||||||||||||||| ||| || ||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
40553991 |
gaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttaattta |
40553931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 65 - 122
Target Start/End: Complemental strand, 38755963 - 38755906
Alignment:
| Q |
65 |
ggaccccttcccggacactgtgtgtgcgggagcttcagtgcaccgacttgccctttaa |
122 |
Q |
| |
|
|||||||||||||||| ||| || ||||||||||| ||||||||| ||||||||||| |
|
|
| T |
38755963 |
ggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttaa |
38755906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 65 - 121
Target Start/End: Complemental strand, 44363185 - 44363129
Alignment:
| Q |
65 |
ggaccccttcccggacactgtgtgtgcgggagcttcagtgcaccgacttgcccttta |
121 |
Q |
| |
|
|||||||||||||||| ||| || ||||||||||| ||||||||| |||||||||| |
|
|
| T |
44363185 |
ggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttta |
44363129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 65 - 120
Target Start/End: Original strand, 5648338 - 5648393
Alignment:
| Q |
65 |
ggaccccttcccggacactgtgtgtgcgggagcttcagtgcaccgacttgcccttt |
120 |
Q |
| |
|
|||||||||||||||| ||| || ||||||||||||||||||| | ||||||||| |
|
|
| T |
5648338 |
ggaccccttcccggaccctgcgtatgcgggagcttcagtgcactgggttgcccttt |
5648393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 65 - 120
Target Start/End: Complemental strand, 20639713 - 20639658
Alignment:
| Q |
65 |
ggaccccttcccggacactgtgtgtgcgggagcttcagtgcaccgacttgcccttt |
120 |
Q |
| |
|
|||||||||||||||| ||| || ||||||||||| ||||||||| ||||||||| |
|
|
| T |
20639713 |
ggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
20639658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 69 - 119
Target Start/End: Original strand, 40915912 - 40915962
Alignment:
| Q |
69 |
cccttcccggacactgtgtgtgcgggagcttcagtgcaccgacttgccctt |
119 |
Q |
| |
|
|||||||||||| ||| || ||||||||||||||||||||| |||||||| |
|
|
| T |
40915912 |
cccttcccggaccctgcgtatgcgggagcttcagtgcaccggattgccctt |
40915962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 65 - 122
Target Start/End: Original strand, 11394932 - 11394989
Alignment:
| Q |
65 |
ggaccccttcccggacactgtgtgtgcgggagcttcagtgcaccgacttgccctttaa |
122 |
Q |
| |
|
||||||||| |||||| ||| || ||||||||||| ||||||||| ||||||||||| |
|
|
| T |
11394932 |
ggacccctttccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttaa |
11394989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 65 - 122
Target Start/End: Original strand, 11404659 - 11404716
Alignment:
| Q |
65 |
ggaccccttcccggacactgtgtgtgcgggagcttcagtgcaccgacttgccctttaa |
122 |
Q |
| |
|
||||||||| |||||| ||| || ||||||||||| ||||||||| ||||||||||| |
|
|
| T |
11404659 |
ggacccctttccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttaa |
11404716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 67 - 120
Target Start/End: Original strand, 54730334 - 54730387
Alignment:
| Q |
67 |
accccttcccggacactgtgtgtgcgggagcttcagtgcaccgacttgcccttt |
120 |
Q |
| |
|
|||||||||||||| ||| || ||||||||||| |||||||||| || |||||| |
|
|
| T |
54730334 |
accccttcccggaccctgcgtatgcgggagctttagtgcaccgaattacccttt |
54730387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 36; Significance: 0.00000000002; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 65 - 120
Target Start/End: Original strand, 6808475 - 6808530
Alignment:
| Q |
65 |
ggaccccttcccggacactgtgtgtgcgggagcttcagtgcaccgacttgcccttt |
120 |
Q |
| |
|
|||||||||||||||| |||||| ||||||||||| ||||||||| ||||||||| |
|
|
| T |
6808475 |
ggaccccttcccggaccctgtgtatgcgggagctttagtgcaccgggttgcccttt |
6808530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 65 - 120
Target Start/End: Original strand, 13267805 - 13267860
Alignment:
| Q |
65 |
ggaccccttcccggacactgtgtgtgcgggagcttcagtgcaccgacttgcccttt |
120 |
Q |
| |
|
||||||||||| |||| ||| || ||||||||||||||||||||| ||||||||| |
|
|
| T |
13267805 |
ggaccccttcctggaccctgcgtatgcgggagcttcagtgcaccgggttgcccttt |
13267860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 65 - 120
Target Start/End: Complemental strand, 29355910 - 29355855
Alignment:
| Q |
65 |
ggaccccttcccggacactgtgtgtgcgggagcttcagtgcaccgacttgcccttt |
120 |
Q |
| |
|
|||||||||||||||| ||| || ||||||||||| ||||||||| ||||||||| |
|
|
| T |
29355910 |
ggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
29355855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 35; Significance: 0.00000000009; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 65 - 123
Target Start/End: Original strand, 13160781 - 13160839
Alignment:
| Q |
65 |
ggaccccttcccggacactgtgtgtgcgggagcttcagtgcaccgacttgccctttaat |
123 |
Q |
| |
|
|||||||||||||||| ||| || ||||||||||||||||| ||| |||||||||||| |
|
|
| T |
13160781 |
ggaccccttcccggaccctgcgtatgcgggagcttcagtgcgccgggttgccctttaat |
13160839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 65 - 120
Target Start/End: Complemental strand, 35107366 - 35107311
Alignment:
| Q |
65 |
ggaccccttcccggacactgtgtgtgcgggagcttcagtgcaccgacttgcccttt |
120 |
Q |
| |
|
|||||||||||||||| |||||| ||||| ||||| ||||||||| ||||||||| |
|
|
| T |
35107366 |
ggaccccttcccggacgctgtgtatgcggaagctttagtgcaccgggttgcccttt |
35107311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 66 - 120
Target Start/End: Complemental strand, 39461048 - 39460994
Alignment:
| Q |
66 |
gaccccttcccggacactgtgtgtgcgggagcttcagtgcaccgacttgcccttt |
120 |
Q |
| |
|
||||||||||||||| ||| || ||||||||||| ||||||||| ||||||||| |
|
|
| T |
39461048 |
gaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
39460994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 65 - 119
Target Start/End: Original strand, 45071344 - 45071398
Alignment:
| Q |
65 |
ggaccccttcccggacactgtgtgtgcgggagcttcagtgcaccgacttgccctt |
119 |
Q |
| |
|
|||||||||||||||| || || ||||||||||||||||||||| |||||||| |
|
|
| T |
45071344 |
ggaccccttcccggaccttgcgtatgcgggagcttcagtgcaccgggttgccctt |
45071398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000001; HSPs: 7)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 65 - 121
Target Start/End: Original strand, 14530400 - 14530456
Alignment:
| Q |
65 |
ggaccccttcccggacactgtgtgtgcgggagcttcagtgcaccgacttgcccttta |
121 |
Q |
| |
|
|||||||||||||||| ||| || ||||||||||| ||||||||| |||||||||| |
|
|
| T |
14530400 |
ggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttta |
14530456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 65 - 120
Target Start/End: Original strand, 9671259 - 9671314
Alignment:
| Q |
65 |
ggaccccttcccggacactgtgtgtgcgggagcttcagtgcaccgacttgcccttt |
120 |
Q |
| |
|
|||||||||||||||| ||| || ||||||||||| ||||||||| ||||||||| |
|
|
| T |
9671259 |
ggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
9671314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 65 - 120
Target Start/End: Original strand, 10543780 - 10543835
Alignment:
| Q |
65 |
ggaccccttcccggacactgtgtgtgcgggagcttcagtgcaccgacttgcccttt |
120 |
Q |
| |
|
|||||||||||||||| ||| || ||||||||||| ||||||||| ||||||||| |
|
|
| T |
10543780 |
ggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
10543835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 65 - 120
Target Start/End: Original strand, 10546243 - 10546298
Alignment:
| Q |
65 |
ggaccccttcccggacactgtgtgtgcgggagcttcagtgcaccgacttgcccttt |
120 |
Q |
| |
|
|||||||||||||||| ||| || ||||||||||| ||||||||| ||||||||| |
|
|
| T |
10546243 |
ggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
10546298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 62 - 121
Target Start/End: Original strand, 14544143 - 14544202
Alignment:
| Q |
62 |
gtcggaccccttcccggacactgtgtgtgcgggagcttcagtgcaccgacttgcccttta |
121 |
Q |
| |
|
|||||||||||||| |||| ||| || ||||||||||| |||||||| | |||||||||| |
|
|
| T |
14544143 |
gtcggaccccttccgggaccctgcgtatgcgggagctttagtgcaccaagttgcccttta |
14544202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 65 - 119
Target Start/End: Complemental strand, 40579804 - 40579750
Alignment:
| Q |
65 |
ggaccccttcccggacactgtgtgtgcgggagcttcagtgcaccgacttgccctt |
119 |
Q |
| |
|
|||||||||||||||| ||| || ||||||||||| ||||||||| |||||||| |
|
|
| T |
40579804 |
ggaccccttcccggaccctgagtatgcgggagctttagtgcaccgggttgccctt |
40579750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 65 - 118
Target Start/End: Original strand, 41409942 - 41409995
Alignment:
| Q |
65 |
ggaccccttcccggacactgtgtgtgcgggagcttcagtgcaccgacttgccct |
118 |
Q |
| |
|
|||||||||||||||| ||| | ||||||||||||||||||||| ||||||| |
|
|
| T |
41409942 |
ggaccccttcccggaccctgcatatgcgggagcttcagtgcaccgggttgccct |
41409995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000001; HSPs: 5)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 65 - 121
Target Start/End: Original strand, 4349741 - 4349797
Alignment:
| Q |
65 |
ggaccccttcccggacactgtgtgtgcgggagcttcagtgcaccgacttgcccttta |
121 |
Q |
| |
|
|||||||||||||||| ||| || ||||||||||| ||||||||| |||||||||| |
|
|
| T |
4349741 |
ggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttta |
4349797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 65 - 120
Target Start/End: Original strand, 27474383 - 27474438
Alignment:
| Q |
65 |
ggaccccttcccggacactgtgtgtgcgggagcttcagtgcaccgacttgcccttt |
120 |
Q |
| |
|
|||||||||||||||| ||| || ||||||||||| ||||||||| ||||||||| |
|
|
| T |
27474383 |
ggaccccttcccggaccctgcgtatgcgggagctttagtgcaccggattgcccttt |
27474438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 65 - 109
Target Start/End: Complemental strand, 4587618 - 4587574
Alignment:
| Q |
65 |
ggaccccttcccggacactgtgtgtgcgggagcttcagtgcaccg |
109 |
Q |
| |
|
|||||||||||||||| ||| | ||||||||||||||||||||| |
|
|
| T |
4587618 |
ggaccccttcccggaccctgcctatgcgggagcttcagtgcaccg |
4587574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 65 - 125
Target Start/End: Complemental strand, 30395781 - 30395721
Alignment:
| Q |
65 |
ggaccccttcccggacactgtgtgtgcgggagcttcagtgcaccgacttgccctttaattt |
125 |
Q |
| |
|
|||||||||||||||| | | | ||||||||||| |||||||||| ||||||||| |||| |
|
|
| T |
30395781 |
ggaccccttcccggaccccgcatatgcgggagctttagtgcaccgagttgcccttttattt |
30395721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 65 - 109
Target Start/End: Complemental strand, 31442444 - 31442400
Alignment:
| Q |
65 |
ggaccccttcccggacactgtgtgtgcgggagcttcagtgcaccg |
109 |
Q |
| |
|
||||||||||||||||||||||| || |||||||| |||||||| |
|
|
| T |
31442444 |
ggaccccttcccggacactgtgtatgtgggagctttggtgcaccg |
31442400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0057
Description:
Target: scaffold0057; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 65 - 120
Target Start/End: Original strand, 46911 - 46966
Alignment:
| Q |
65 |
ggaccccttcccggacactgtgtgtgcgggagcttcagtgcaccgacttgcccttt |
120 |
Q |
| |
|
|||||||||||||||| ||| || ||||||||||| ||||||||| ||||||||| |
|
|
| T |
46911 |
ggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
46966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000005; HSPs: 5)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 65 - 120
Target Start/End: Original strand, 16957394 - 16957449
Alignment:
| Q |
65 |
ggaccccttcccggacactgtgtgtgcgggagcttcagtgcaccgacttgcccttt |
120 |
Q |
| |
|
|||||||||||||||| ||| || ||||||||||| ||||||||| ||||||||| |
|
|
| T |
16957394 |
ggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
16957449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 65 - 120
Target Start/End: Original strand, 25622540 - 25622595
Alignment:
| Q |
65 |
ggaccccttcccggacactgtgtgtgcgggagcttcagtgcaccgacttgcccttt |
120 |
Q |
| |
|
|||||||||||||||| ||| || ||||||||||| ||||||||| ||||||||| |
|
|
| T |
25622540 |
ggaccccttcccggaccctgcgtatgcgggagctttagtgcaccggattgcccttt |
25622595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 69 - 120
Target Start/End: Original strand, 32354211 - 32354262
Alignment:
| Q |
69 |
cccttcccggacactgtgtgtgcgggagcttcagtgcaccgacttgcccttt |
120 |
Q |
| |
|
|||||||||||| |||||| ||||||||||| ||||||||| ||||||||| |
|
|
| T |
32354211 |
cccttcccggaccctgtgtatgcgggagctttagtgcaccgggttgcccttt |
32354262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 65 - 120
Target Start/End: Original strand, 38879663 - 38879718
Alignment:
| Q |
65 |
ggaccccttcccggacactgtgtgtgcgggagcttcagtgcaccgacttgcccttt |
120 |
Q |
| |
|
|||||||||||||||| ||| || ||||||||||| ||||||||| ||||||||| |
|
|
| T |
38879663 |
ggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
38879718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 65 - 109
Target Start/End: Original strand, 3771419 - 3771463
Alignment:
| Q |
65 |
ggaccccttcccggacactgtgtgtgcgggagcttcagtgcaccg |
109 |
Q |
| |
|
|||||||||||||||| |||||| || |||||||| ||||||||| |
|
|
| T |
3771419 |
ggaccccttcccggactctgtgtatgtgggagctttagtgcaccg |
3771463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000005; HSPs: 6)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 65 - 120
Target Start/End: Complemental strand, 13628845 - 13628790
Alignment:
| Q |
65 |
ggaccccttcccggacactgtgtgtgcgggagcttcagtgcaccgacttgcccttt |
120 |
Q |
| |
|
|||||||||||||||| ||| || ||||||||||| ||||||||| ||||||||| |
|
|
| T |
13628845 |
ggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
13628790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 65 - 120
Target Start/End: Original strand, 16735542 - 16735597
Alignment:
| Q |
65 |
ggaccccttcccggacactgtgtgtgcgggagcttcagtgcaccgacttgcccttt |
120 |
Q |
| |
|
|||||||||||||||||||| || ||||| ||||||||||||| | ||||||||| |
|
|
| T |
16735542 |
ggaccccttcccggacactgcgtatgcggtagcttcagtgcactgggttgcccttt |
16735597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 65 - 120
Target Start/End: Complemental strand, 40272867 - 40272812
Alignment:
| Q |
65 |
ggaccccttcccggacactgtgtgtgcgggagcttcagtgcaccgacttgcccttt |
120 |
Q |
| |
|
|||||||||||||||| ||| || ||||||||||| ||||||||| ||||||||| |
|
|
| T |
40272867 |
ggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
40272812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 65 - 120
Target Start/End: Original strand, 54484793 - 54484848
Alignment:
| Q |
65 |
ggaccccttcccggacactgtgtgtgcgggagcttcagtgcaccgacttgcccttt |
120 |
Q |
| |
|
|||||||||||||||| ||| || ||||||||||| ||||||||| ||||||||| |
|
|
| T |
54484793 |
ggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
54484848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 65 - 119
Target Start/End: Original strand, 22609867 - 22609921
Alignment:
| Q |
65 |
ggaccccttcccggacactgtgtgtgcgggagcttcagtgcaccgacttgccctt |
119 |
Q |
| |
|
|||||||||||||||| || || ||||||||||||||||||||| |||||||| |
|
|
| T |
22609867 |
ggaccccttcccggaccttgcgtatgcgggagcttcagtgcaccgggttgccctt |
22609921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 65 - 121
Target Start/End: Complemental strand, 10795478 - 10795422
Alignment:
| Q |
65 |
ggaccccttcccggacactgtgtgtgcgggagcttcagtgcaccgacttgcccttta |
121 |
Q |
| |
|
||||||||||| |||| ||| || |||||||||||||||||||| |||||||||| |
|
|
| T |
10795478 |
ggaccccttcctggaccctgcgtatgcgggagcttcagtgcaccaggttgcccttta |
10795422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University