View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17858_high_23 (Length: 201)
Name: NF17858_high_23
Description: NF17858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17858_high_23 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 144; Significance: 6e-76; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 144; E-Value: 6e-76
Query Start/End: Original strand, 10 - 164
Target Start/End: Complemental strand, 38515305 - 38515150
Alignment:
| Q |
10 |
tagataatactgagaggagagtatgtatatttggattgacatttccacacataaatttgtattagctaaattttgcaaatttattttgattaaaa-taaa |
108 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
38515305 |
tagattatactgagaggagagtatgtatatttggattgacatttccacacataaatttgtattagctaaattttgcaaatttattttgattaaaagtaaa |
38515206 |
T |
 |
| Q |
109 |
ttctatttttgccggatgattaaaaactagttcattgcaacttgagctgtgtttga |
164 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38515205 |
ttctatttttgccggatgattaaaaactagttcattgcaacttgagctgtgtttga |
38515150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 156 - 194
Target Start/End: Complemental strand, 31871538 - 31871500
Alignment:
| Q |
156 |
tgtgtttgattgagtgcggagctatgaatatggaaagag |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31871538 |
tgtgtttgattgagtgcggagctatgaatatggaaagag |
31871500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University