View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17858_low_11 (Length: 327)
Name: NF17858_low_11
Description: NF17858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17858_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 33 - 314
Target Start/End: Original strand, 2500673 - 2500958
Alignment:
| Q |
33 |
atgcaaccttaggtaatagttcaccattttacactagacgtaatttttgtgtgggaaggtttaggaatttgta----gctaagaaaaataattattttct |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2500673 |
atgcaaccttaggtaatagttcaccattttacactagacgtaatttttgtgtggaaaggtttaggaatttgtacgtagctaagaaaaataattattttct |
2500772 |
T |
 |
| Q |
129 |
tagcgtaatcgtttgataaaaaatgagatcattgtcatagacgcaagtaagttatagtatcatctttttgacaaaatatacaatgaataaaccaagcaaa |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
2500773 |
tagcgtaatcgtttgataaaaaatgagatcattgtcatagacgcaagtaagttataataccatcttttcgacaaaatatacaatgaataaaccaaacaaa |
2500872 |
T |
 |
| Q |
229 |
caactaataaaccgagaacaaggttagtaaggtaagcaccaaatttcgcacgatgacaacacttggcatgtatagtaagatcgtga |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
2500873 |
caactaataaaccgagaacaaggttagtaaggtaagcaccaaatttcgcaagatgacaacacttggcatgtatagtaagattgtga |
2500958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University