View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17858_low_16 (Length: 265)

Name: NF17858_low_16
Description: NF17858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17858_low_16
NF17858_low_16
[»] chr6 (1 HSPs)
chr6 (18-96)||(2996224-2996302)
[»] scaffold0011 (1 HSPs)
scaffold0011 (23-94)||(13415-13486)


Alignment Details
Target: chr6 (Bit Score: 71; Significance: 3e-32; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 18 - 96
Target Start/End: Complemental strand, 2996302 - 2996224
Alignment:
18 tgtgttcgtgacttttggagaagtgtaatttgcttttgcttgccactatcttgtattgattgctccaatgtgctattgt 96  Q
    |||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||    
2996302 tgtgttcgtgacttttggagaagtgtgatttgcttttgcttgccactagcttgtattgattgctccaatgtgctattgt 2996224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0011 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: scaffold0011
Description:

Target: scaffold0011; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 23 - 94
Target Start/End: Complemental strand, 13486 - 13415
Alignment:
23 tcgtgacttttggagaagtgtaatttgcttttgcttgccactatcttgtattgattgctccaatgtgctatt 94  Q
    ||||||||||||||||||||| ||||| ||||||||||||||| ||||| ||||||||| |||||| |||||    
13486 tcgtgacttttggagaagtgtgatttgtttttgcttgccactagcttgtgttgattgcttcaatgttctatt 13415  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University