View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17858_low_16 (Length: 265)
Name: NF17858_low_16
Description: NF17858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17858_low_16 |
 |  |
|
| [»] scaffold0011 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 71; Significance: 3e-32; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 18 - 96
Target Start/End: Complemental strand, 2996302 - 2996224
Alignment:
| Q |
18 |
tgtgttcgtgacttttggagaagtgtaatttgcttttgcttgccactatcttgtattgattgctccaatgtgctattgt |
96 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
2996302 |
tgtgttcgtgacttttggagaagtgtgatttgcttttgcttgccactagcttgtattgattgctccaatgtgctattgt |
2996224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: scaffold0011
Description:
Target: scaffold0011; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 23 - 94
Target Start/End: Complemental strand, 13486 - 13415
Alignment:
| Q |
23 |
tcgtgacttttggagaagtgtaatttgcttttgcttgccactatcttgtattgattgctccaatgtgctatt |
94 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||||||||||||| ||||| ||||||||| |||||| ||||| |
|
|
| T |
13486 |
tcgtgacttttggagaagtgtgatttgtttttgcttgccactagcttgtgttgattgcttcaatgttctatt |
13415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University