View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17858_low_18 (Length: 250)
Name: NF17858_low_18
Description: NF17858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17858_low_18 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 7 - 250
Target Start/End: Complemental strand, 25135621 - 25135375
Alignment:
| Q |
7 |
ggagcacagatcaaacagtaaaaattctcctcaccttcttcatgttcctacgacaaacaggacatatacctgctgcctcggctatcctgcatagataagg |
106 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25135621 |
ggagcactgatcaaacagtaaaaattctcctcaccttcttcatgttcctacgacaaacaggacatatacctgctgcctcggctatcctgcatagataagg |
25135522 |
T |
 |
| Q |
107 |
ttgg---tacatcattcaccataaaagcatcaggcaccataatgcattatcatgtatcatgtatgtcactgaaaatgtaatttgcagagtaaaggtatca |
203 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
25135521 |
ttgggcatacatcattcaccataaaagcatcaggcaccataatgcattatcatgtatcatgtatgtcactgaaaatgtaatttgtagagtaaaggtatcg |
25135422 |
T |
 |
| Q |
204 |
aattcatcaacttgcaaatgtcaaaatcatacaagaggaatcaaatt |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25135421 |
aattcatcaacttgcaaatgtcaaaatcatacaagaggaatcaaatt |
25135375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University