View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17859_low_8 (Length: 226)
Name: NF17859_low_8
Description: NF17859
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17859_low_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 156; Significance: 5e-83; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 1 - 168
Target Start/End: Complemental strand, 38175595 - 38175428
Alignment:
| Q |
1 |
gtttttatgaggcattttcttggaaatttggtagcagaaacccaatttgggaattatgggtctgaataactgaatttgatccatgttgccgaccccgatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38175595 |
gtttttatgaggcattttcttggaaatttggtaacagaaacccaatttgggcattatgggtctgaataactgaatttgatccatgttgccgaccccgatt |
38175496 |
T |
 |
| Q |
101 |
atcatttgattaggcgtcgtataatcttgtcaaacagtttcaataggagctttcttgttgaattgtta |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
38175495 |
atcatttgattaggcgtcgtataatcttgtcaaacaatttcaataggagctttcttgttgaattgtta |
38175428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 1 - 168
Target Start/End: Complemental strand, 38202819 - 38202652
Alignment:
| Q |
1 |
gtttttatgaggcattttcttggaaatttggtagcagaaacccaatttgggaattatgggtctgaataactgaatttgatccatgttgccgaccccgatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38202819 |
gtttttatgaggcattttcttggaaatttggtaacagaaacccaatttgggcattatgggtctgaataactgaatttgatccatgttgccgaccccgatt |
38202720 |
T |
 |
| Q |
101 |
atcatttgattaggcgtcgtataatcttgtcaaacagtttcaataggagctttcttgttgaattgtta |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
38202719 |
atcatttgattaggcgtcgtataatcttgtcaaacaatttcaataggagctttcttgttgaattgtta |
38202652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 75 - 168
Target Start/End: Original strand, 38164310 - 38164403
Alignment:
| Q |
75 |
tttgatccatgttgccgaccccgattatcatttgattaggcgtcgtataatcttgtcaaacagtttcaataggagctttcttgttgaattgtta |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| | ||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
38164310 |
tttgatccatgttgccgaccccgattatcattagattacgagtcgtataatcttgtcaaacaatttcaataggagctttcttgttgaattgtta |
38164403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 3 - 42
Target Start/End: Original strand, 38164253 - 38164292
Alignment:
| Q |
3 |
ttttatgaggcattttcttggaaatttggtagcagaaacc |
42 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
38164253 |
ttttatgaggcattttgttggaaatttggtaacagaaacc |
38164292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University