View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17860_low_16 (Length: 233)
Name: NF17860_low_16
Description: NF17860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17860_low_16 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 19 - 233
Target Start/End: Original strand, 29008827 - 29009041
Alignment:
| Q |
19 |
gaagcaccaccaacggtgtggttaccaccacaaacgcaacggaagagaattgaagccaagacgaccacgaacatagctttcactgcccagactggcctca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29008827 |
gaagcaccaccaacggtgtggttaccaccacaaacgcaacggaagagaatcgaagccaagacgaccacgaacatagctttcactgcccagactggcctca |
29008926 |
T |
 |
| Q |
119 |
ttttcctannnnnnnnnnnnnnnnnnnnnnnncacagagttaactatagcttcgattcaaattcttcatctaattgaatgaatataacaccgtaacagtg |
218 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
29008927 |
ttttcctacaaatcaaaccaaaaaatcaaaaacacagagttaactatagcttcgattcaaattcttcatctaatcgaatgaatacaacaccgtaacagta |
29009026 |
T |
 |
| Q |
219 |
tcaaatgaaattgaa |
233 |
Q |
| |
|
||||||| ||||||| |
|
|
| T |
29009027 |
tcaaatgcaattgaa |
29009041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University