View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17860_low_9 (Length: 311)
Name: NF17860_low_9
Description: NF17860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17860_low_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 18 - 305
Target Start/End: Original strand, 511861 - 512142
Alignment:
| Q |
18 |
gtttccgtccgctggtttgcatttgcgtgggccgaaaattcgccacaaatgtttgcgagggaaatatttgcatgggagctttgtccgccgcaaatttgca |
117 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
511861 |
gtttccgtccactggtttgcatttgcatgggccgaaaattcgccacaaatgtttgcgagggcaatatttgcatgggagctttgtccaccgcaaatttgca |
511960 |
T |
|
| Q |
118 |
tttgcgtgggctttttgtgtttttgtgtgggattttgatacacgctaattccaaacattcttgcagtggtactactacaacaaatgctgaagaaatatgg |
217 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
511961 |
tttgcgtgggctttt--------tgtgtgggattttgatacacgctaattccatacattcttgcagtggtactactacaacaaatgctgaagaaatatgg |
512052 |
T |
|
| Q |
218 |
gtgcaaagaagaacttgtataatgtcata-ttttgtaagcaaatcaaaag-ttttcagaaacatcttgttctttcctacttgattttctt |
305 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
512053 |
gtgcaaagaagaacttgtataatgtcatacttttgtaagcaaatcaaaagtttttcagaaacatcttgttctttccttcttgattttctt |
512142 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 55; Significance: 1e-22; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 58 - 132
Target Start/End: Complemental strand, 5675988 - 5675914
Alignment:
| Q |
58 |
cgccacaaatgtttgcgagggaaatatttgcatgggagctttgtccgccgcaaatttgcatttgcgtgggctttt |
132 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
5675988 |
cgccacaaatgtttgcgagggcaatatttgcaagggagctttgtccgccgcaaatttgtgtttgcgtgggatttt |
5675914 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 58 - 132
Target Start/End: Complemental strand, 5701040 - 5700966
Alignment:
| Q |
58 |
cgccacaaatgtttgcgagggaaatatttgcatgggagctttgtccgccgcaaatttgcatttgcgtgggctttt |
132 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
5701040 |
cgccacaaatgtttgcgagggcaatatttgcaagggagctttgtccgccgcaaatttgtgtttgcgtgggatttt |
5700966 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University