View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17861_high_49 (Length: 253)
Name: NF17861_high_49
Description: NF17861
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17861_high_49 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 1 - 253
Target Start/End: Complemental strand, 48894659 - 48894407
Alignment:
| Q |
1 |
aacaacaacaatgtcaaagatgacaagaacaaaggacaaaaacaagggctggtcaaagggcttgaagtcttcaaaaatcagcagaaatttcctgctttta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48894659 |
aacaacaacaatgtcaaagatgacaagaacagaggacaaaaacaaggactggtcaaagggcttgaagtcttcaaaaatcagcagaaatttcctgctttta |
48894560 |
T |
|
| Q |
101 |
gttctgaagaggatgatgaatactacgaatatgacgaggacgaagaggaggaggatgaagagatgcggttcatcagggagagaaccaatcatcttcagat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
48894559 |
gttctgaagaggatgatgaatactacgaatatgacgaggacgaagaggaggaggatgaagagatgcggttcatcagggagagaactaatcatcttcagat |
48894460 |
T |
|
| Q |
201 |
gctaaagcaagcgaatgatgcaaacaatgtgaagaaaggtattatagctaaga |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48894459 |
gctaaagcaagcgaatgatgcaaacaatgtgaagaaaggtattatagctaaga |
48894407 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University