View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17861_high_58 (Length: 235)
Name: NF17861_high_58
Description: NF17861
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17861_high_58 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 25 - 220
Target Start/End: Original strand, 35054570 - 35054765
Alignment:
| Q |
25 |
atactaccagtttataataattcaaatggggttgtgtgcaaggctattcgaagtaatttgatgaaatttaggacatttaacatggaatttgaaaacatag |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35054570 |
atactaccagtttataataattcaaatggggttgtgtgcaaggctattcgaagtaatttgatgaaatttaggacatttaacatggaatttgaaaacatag |
35054669 |
T |
 |
| Q |
125 |
cgactagtagtatttagggcaagtggaccagctacctggaaatgccgcaaagtaagtggaagtaaagccaaacatgggacaccatgtagacctaac |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35054670 |
cgactagtagtatttagggcaagtggaccagctacctggaaatgccgcaaagtaagtggaagtaaagccaaacatgggacaccatgtagacctaac |
35054765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 48; Significance: 1e-18; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 25 - 116
Target Start/End: Original strand, 33176520 - 33176611
Alignment:
| Q |
25 |
atactaccagtttataataattcaaatggggttgtgtgcaaggctattcgaagtaatttgatgaaatttaggacatttaacatggaatttga |
116 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||| || || ||||| |||| || |||| |||||||| ||||||||||||| |
|
|
| T |
33176520 |
atactaccagtttagaataattcaaatggggttgtgtgcaagactgttagaagtggtttgttggaattaaggacattgcacatggaatttga |
33176611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 25 - 66
Target Start/End: Complemental strand, 35382223 - 35382182
Alignment:
| Q |
25 |
atactaccagtttataataattcaaatggggttgtgtgcaag |
66 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
35382223 |
atactaccagtttagaataattcaaatggggttgtgtgcaag |
35382182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University