View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17861_high_60 (Length: 225)
Name: NF17861_high_60
Description: NF17861
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17861_high_60 |
 |  |
|
| [»] scaffold0004 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0004 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: scaffold0004
Description:
Target: scaffold0004; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 8 - 207
Target Start/End: Complemental strand, 222929 - 222730
Alignment:
| Q |
8 |
gagtgagatgaagaggttatggattgaatattttttatggaggtttgggaggttttctttttcgtaaccgagtgagagaggggtgggaaagtttggtttt |
107 |
Q |
| |
|
|||||| | ||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
222929 |
gagtgaaaggaagatgttatggattgaatattttttatggaggtttgagaggttttctttttcgtaactgagtgagagaggggtgggaaagtttggtttt |
222830 |
T |
 |
| Q |
108 |
aaatgaatggtcatgatgcaataaagtgatttgatttagatgattcaattcagttttcgtattgaatctatttgaatcgattcaaaaggaaggtttttca |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
222829 |
aaatgaatggtcatgatgcaataaagtgatttgatttagatgattcaattcagttttcgtattgaatctatttgaatcgattcaaaaggaaggtttttca |
222730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University